ID: 1167358138_1167358153

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1167358138 1167358153
Species Human (GRCh38) Human (GRCh38)
Location 19:49016450-49016472 19:49016493-49016515
Sequence CCGCAGGCCAGAGAGGCAGACCA CTGTGGGTCTGGCCCTGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 28, 4: 332} {0: 7, 1: 0, 2: 2, 3: 37, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!