ID: 1167364572_1167364585

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1167364572 1167364585
Species Human (GRCh38) Human (GRCh38)
Location 19:49048129-49048151 19:49048152-49048174
Sequence CCACCCTTCCTCCCCCGCTGCCT CTGTGGGTCTGGCCCTGAGGTGG
Strand - +
Off-target summary {0: 7, 1: 2, 2: 36, 3: 1248, 4: 12989} {0: 7, 1: 0, 2: 2, 3: 37, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!