ID: 1167373913_1167373923

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1167373913 1167373923
Species Human (GRCh38) Human (GRCh38)
Location 19:49101301-49101323 19:49101321-49101343
Sequence CCCAGGGCCTGGTGTGCAGGCTG CTGTTGTGGGGTTGGTGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 50, 4: 414} {0: 1, 1: 19, 2: 745, 3: 10231, 4: 10181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!