ID: 1167479340_1167479348

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1167479340 1167479348
Species Human (GRCh38) Human (GRCh38)
Location 19:49719931-49719953 19:49719982-49720004
Sequence CCAAGGTAAATTTGACCCTCTAG CGCCGATCAGCTTCAGCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 4, 4: 73} {0: 1, 1: 1, 2: 1, 3: 3, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!