ID: 1167483788_1167483796

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1167483788 1167483796
Species Human (GRCh38) Human (GRCh38)
Location 19:49748332-49748354 19:49748373-49748395
Sequence CCTGGAGGAAGGGCAGGTGTTGG CCTGCAGAGACTGCACGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 446} {0: 1, 1: 0, 2: 1, 3: 15, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!