ID: 1167576547_1167576569

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1167576547 1167576569
Species Human (GRCh38) Human (GRCh38)
Location 19:50320520-50320542 19:50320560-50320582
Sequence CCCCTCTCCTCCCTCCCCTGGGC GGTCCCAGGGGATCAGTAGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 228, 4: 1769} {0: 1, 1: 0, 2: 0, 3: 12, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!