ID: 1167632306_1167632322

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1167632306 1167632322
Species Human (GRCh38) Human (GRCh38)
Location 19:50632618-50632640 19:50632655-50632677
Sequence CCCGCCTCCGCCTACCAGGCCTG GGGCCTAGGTCTTTGCGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 84, 4: 676} {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!