ID: 1167644376_1167644384

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1167644376 1167644384
Species Human (GRCh38) Human (GRCh38)
Location 19:50697736-50697758 19:50697761-50697783
Sequence CCAAGTCTTCCCATCTACCTCCC TACCCCACCCCCATTAGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 388} {0: 1, 1: 0, 2: 0, 3: 20, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!