ID: 1167672258_1167672265

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1167672258 1167672265
Species Human (GRCh38) Human (GRCh38)
Location 19:50859966-50859988 19:50860008-50860030
Sequence CCTTAGGGTGATTCTGGGGGCCC CTTCAAGGTATCACGTCATGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 17, 4: 179} {0: 1, 1: 1, 2: 0, 3: 3, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!