ID: 1167675009_1167675011

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1167675009 1167675011
Species Human (GRCh38) Human (GRCh38)
Location 19:50878397-50878419 19:50878413-50878435
Sequence CCCTTAGGGTGATTCTGGGGGTC GGGGGTCCACTTGTCTGTAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 101} {0: 1, 1: 1, 2: 0, 3: 1, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!