ID: 1167675009_1167675016

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1167675009 1167675016
Species Human (GRCh38) Human (GRCh38)
Location 19:50878397-50878419 19:50878440-50878462
Sequence CCCTTAGGGTGATTCTGGGGGTC CTTCAAGGTATCACATCATGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 101} {0: 1, 1: 1, 2: 1, 3: 14, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!