ID: 1167698617_1167698628

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1167698617 1167698628
Species Human (GRCh38) Human (GRCh38)
Location 19:51029414-51029436 19:51029443-51029465
Sequence CCTTGAAGGACTCCCCCACACAC GCCCCCAGAATCACCCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 167} {0: 1, 1: 0, 2: 5, 3: 13, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!