ID: 1167820937_1167820946

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1167820937 1167820946
Species Human (GRCh38) Human (GRCh38)
Location 19:51927274-51927296 19:51927315-51927337
Sequence CCGTCCCGCGCTATCCCTGAATA ACTTTACCTTCCGTACGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 41} {0: 1, 1: 0, 2: 0, 3: 0, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!