ID: 1167874192_1167874199

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1167874192 1167874199
Species Human (GRCh38) Human (GRCh38)
Location 19:52398008-52398030 19:52398028-52398050
Sequence CCCTCCACCCCGAGTAAATTCAG CAGACATCCTTTGAGAGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 105} {0: 1, 1: 1, 2: 2, 3: 42, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!