ID: 1168078484_1168078499

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1168078484 1168078499
Species Human (GRCh38) Human (GRCh38)
Location 19:53992913-53992935 19:53992964-53992986
Sequence CCGGCGGCGGGGGGCCGCGGGCC GGGGCTGACGCCCGAGCGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 422} {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!