ID: 1168081299_1168081308

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1168081299 1168081308
Species Human (GRCh38) Human (GRCh38)
Location 19:54012342-54012364 19:54012376-54012398
Sequence CCTTTCTCCCTCTGTAAATACGT GCTGTATGTGGGTTGCTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 165} {0: 1, 1: 0, 2: 0, 3: 9, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!