ID: 1168095163_1168095173

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1168095163 1168095173
Species Human (GRCh38) Human (GRCh38)
Location 19:54110261-54110283 19:54110290-54110312
Sequence CCCTCCGGCTCCCCTCTCACCAT GTCCTGAGTGCCCTCCAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 332} {0: 1, 1: 0, 2: 0, 3: 19, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!