ID: 1168110562_1168110569

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1168110562 1168110569
Species Human (GRCh38) Human (GRCh38)
Location 19:54189457-54189479 19:54189477-54189499
Sequence CCGGGCTGCGCAGATCAGGCCGG CGGGGAAGAAGCCACGGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105} {0: 1, 1: 0, 2: 1, 3: 14, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!