ID: 1168160002_1168160008

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1168160002 1168160008
Species Human (GRCh38) Human (GRCh38)
Location 19:54503778-54503800 19:54503805-54503827
Sequence CCCCAAAGGCAGTGCTGGGTGGG ATGTTGATTCTTAGAGGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 39, 4: 276} {0: 2, 1: 0, 2: 0, 3: 6, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!