ID: 1168169000_1168169014

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1168169000 1168169014
Species Human (GRCh38) Human (GRCh38)
Location 19:54574123-54574145 19:54574161-54574183
Sequence CCCAGCTGTCCCAGGTCCCTCCT GGGGCCACCCCCGTGCAGCTGGG
Strand - +
Off-target summary {0: 4, 1: 7, 2: 4, 3: 41, 4: 491} {0: 2, 1: 2, 2: 0, 3: 21, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!