ID: 1168170801_1168170807

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1168170801 1168170807
Species Human (GRCh38) Human (GRCh38)
Location 19:54587368-54587390 19:54587399-54587421
Sequence CCTTCAGCGTGGTGGAGCCTCAG CTGATGATCCCAGGAGGCTCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 136} {0: 1, 1: 3, 2: 2, 3: 25, 4: 414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!