ID: 1168327038_1168327055

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1168327038 1168327055
Species Human (GRCh38) Human (GRCh38)
Location 19:55543830-55543852 19:55543881-55543903
Sequence CCACCCCCTTCATTGACTCCAGT GCCTTTCCACGATTGTGTTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!