ID: 1168345477_1168345489

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1168345477 1168345489
Species Human (GRCh38) Human (GRCh38)
Location 19:55648480-55648502 19:55648507-55648529
Sequence CCAGCCCCCACCACCGGGGGACG GCCCGCCCACGCGAGTGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 229} {0: 1, 1: 0, 2: 1, 3: 11, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!