ID: 1168459086_1168459093

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1168459086 1168459093
Species Human (GRCh38) Human (GRCh38)
Location 19:56538865-56538887 19:56538892-56538914
Sequence CCGGGGGCGGGGCGGCTCCGCGG GCCCAGTGGATGCCGGGCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 388} {0: 1, 1: 0, 2: 1, 3: 42, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!