ID: 1168643519_1168643524

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1168643519 1168643524
Species Human (GRCh38) Human (GRCh38)
Location 19:58045371-58045393 19:58045389-58045411
Sequence CCTCCAGGACACCATCCAGGAGA GGAGATGGCCTTGAAGAACGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 29, 4: 361} {0: 1, 1: 1, 2: 0, 3: 13, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!