ID: 1168649975_1168649982

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1168649975 1168649982
Species Human (GRCh38) Human (GRCh38)
Location 19:58086620-58086642 19:58086644-58086666
Sequence CCTGTATCTGGCAAGGAGGGTGG AATGTGGGCGCCTTGGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 160} {0: 1, 1: 0, 2: 1, 3: 12, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!