ID: 1168685661_1168685676

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1168685661 1168685676
Species Human (GRCh38) Human (GRCh38)
Location 19:58347689-58347711 19:58347726-58347748
Sequence CCCCAGGCCACACCCCAGGCCAC CCGCGCCTGCGCCTCAGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 13, 3: 90, 4: 709} {0: 1, 1: 0, 2: 4, 3: 25, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!