ID: 1168685667_1168685676

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1168685667 1168685676
Species Human (GRCh38) Human (GRCh38)
Location 19:58347702-58347724 19:58347726-58347748
Sequence CCCAGGCCACACCCCAGGCCGCG CCGCGCCTGCGCCTCAGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 354} {0: 1, 1: 0, 2: 4, 3: 25, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!