ID: 1168724863_1168724866

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1168724863 1168724866
Species Human (GRCh38) Human (GRCh38)
Location 19:58575552-58575574 19:58575572-58575594
Sequence CCCAGCTAAAGCAGACGGCTCGC CGCACTGCGACCCGAAGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36} {0: 1, 1: 0, 2: 0, 3: 3, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!