ID: 1168757300_1168757314

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1168757300 1168757314
Species Human (GRCh38) Human (GRCh38)
Location 20:326236-326258 20:326288-326310
Sequence CCCGGACTACAAGTACCGGCCGC GCGCGGCCCCGCCCCCCCGGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 30, 4: 432} {0: 1, 1: 0, 2: 6, 3: 62, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!