ID: 1168757368_1168757377

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1168757368 1168757377
Species Human (GRCh38) Human (GRCh38)
Location 20:326455-326477 20:326479-326501
Sequence CCTGGTCGAGACCCCGGGGCGGG GCTGTGGAGGATGGTCCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 105} {0: 1, 1: 0, 2: 2, 3: 17, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!