ID: 1168891987_1168892006

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1168891987 1168892006
Species Human (GRCh38) Human (GRCh38)
Location 20:1300709-1300731 20:1300762-1300784
Sequence CCGGTGAGCGGGTGGCCACGAGC TCAGGGAAACCAGGGCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 61} {0: 1, 1: 0, 2: 3, 3: 28, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!