ID: 1168904560_1168904563

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1168904560 1168904563
Species Human (GRCh38) Human (GRCh38)
Location 20:1392833-1392855 20:1392847-1392869
Sequence CCGGTGTAGTGCACCACGCAGGT CACGCAGGTCTGGCCGCGCTTGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 2, 3: 3, 4: 65} {0: 1, 1: 0, 2: 0, 3: 11, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!