ID: 1168904560_1168904569

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1168904560 1168904569
Species Human (GRCh38) Human (GRCh38)
Location 20:1392833-1392855 20:1392877-1392899
Sequence CCGGTGTAGTGCACCACGCAGGT GCGCCCTGAGGAGACAGAGACGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 2, 3: 3, 4: 65} {0: 1, 1: 0, 2: 2, 3: 37, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!