ID: 1168924198_1168924204

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1168924198 1168924204
Species Human (GRCh38) Human (GRCh38)
Location 20:1566160-1566182 20:1566196-1566218
Sequence CCTTCTGTTTCCAGCAGATGTAG CAACCACCAGTAGCAGCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 187} {0: 1, 1: 0, 2: 3, 3: 12, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!