ID: 1168986382_1168986387

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1168986382 1168986387
Species Human (GRCh38) Human (GRCh38)
Location 20:2052551-2052573 20:2052576-2052598
Sequence CCCTTATGCTCCTATATCAGTCA CTTCGGATACGAGCCACCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 124} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!