ID: 1169074364_1169074381

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1169074364 1169074381
Species Human (GRCh38) Human (GRCh38)
Location 20:2752135-2752157 20:2752176-2752198
Sequence CCCCCCGCGCACCCGGGCCGCTC CACCCACACCCCGCCGTCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 278} {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!