ID: 1169132132_1169132138

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1169132132 1169132138
Species Human (GRCh38) Human (GRCh38)
Location 20:3171825-3171847 20:3171867-3171889
Sequence CCCTGAGATGACAGCCTGTTGCC CACCTCAGCCCTCAGTGCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 54, 4: 466}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!