ID: 1169143556_1169143577

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1169143556 1169143577
Species Human (GRCh38) Human (GRCh38)
Location 20:3238931-3238953 20:3238983-3239005
Sequence CCCGCGCCCTCCTCCCCGCGGCT CCCCGGCCCGCGCAGGCAGACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 14, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!