ID: 1169180157_1169180163

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1169180157 1169180163
Species Human (GRCh38) Human (GRCh38)
Location 20:3557443-3557465 20:3557488-3557510
Sequence CCCAGCCAAGGTGTCATTCTGCT CTCAAACAAGAGTGAATTCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!