ID: 1169193928_1169193935

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1169193928 1169193935
Species Human (GRCh38) Human (GRCh38)
Location 20:3673505-3673527 20:3673546-3673568
Sequence CCGTGGGAGGGCGGTCACTGCGG CTCCCTCGCCCCCGCCCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96} {0: 1, 1: 0, 2: 4, 3: 48, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!