ID: 1169228880_1169228884

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1169228880 1169228884
Species Human (GRCh38) Human (GRCh38)
Location 20:3873725-3873747 20:3873772-3873794
Sequence CCTTGATCTTGGACTTCCCAGCC TTGTTGTTTACAAATTACCCAGG
Strand - +
Off-target summary {0: 1034, 1: 2703, 2: 3854, 3: 4002, 4: 4272} {0: 1, 1: 0, 2: 14, 3: 96, 4: 519}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!