ID: 1169332185_1169332189

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1169332185 1169332189
Species Human (GRCh38) Human (GRCh38)
Location 20:4724724-4724746 20:4724750-4724772
Sequence CCTTCATCAAGCAAGGCCGCAAG GACATTGACTTCGGAGCCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62} {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!