ID: 1169361272_1169361276

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1169361272 1169361276
Species Human (GRCh38) Human (GRCh38)
Location 20:4951317-4951339 20:4951352-4951374
Sequence CCAGCACTAACTCAGAAGTAAGC ATCACAAAAGACTGAAACGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!