ID: 1169422931_1169422942

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1169422931 1169422942
Species Human (GRCh38) Human (GRCh38)
Location 20:5474247-5474269 20:5474290-5474312
Sequence CCACCTGGGACTCTGCTGTGCTG TCGCAGAGGGGCCATCAGGGAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 16, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!