ID: 1169478071_1169478081

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1169478071 1169478081
Species Human (GRCh38) Human (GRCh38)
Location 20:5950327-5950349 20:5950362-5950384
Sequence CCACGAAGTCGCCGTCGCGGATG GGATGCTGTGGTTGTGGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 18} {0: 1, 1: 0, 2: 3, 3: 22, 4: 370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!