ID: 1169483523_1169483542

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1169483523 1169483542
Species Human (GRCh38) Human (GRCh38)
Location 20:6006513-6006535 20:6006566-6006588
Sequence CCCGGGCGGCCAGTGGGGCCCGG AGGCGGCGGCGGGCCGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 416} {0: 1, 1: 0, 2: 5, 3: 91, 4: 732}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!