ID: 1169488431_1169488434

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1169488431 1169488434
Species Human (GRCh38) Human (GRCh38)
Location 20:6052493-6052515 20:6052511-6052533
Sequence CCTGCAGCTGCTCCAGGTGGCCG GGCCGAGCTCGGAAGTGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 376} {0: 1, 1: 0, 2: 0, 3: 1, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!