ID: 1169849599_1169849606

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1169849599 1169849606
Species Human (GRCh38) Human (GRCh38)
Location 20:10035057-10035079 20:10035076-10035098
Sequence CCTGCGCTCACCTGCCCGCGCGC GCGCTCGCCTTCCGGGGACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 256} {0: 1, 1: 0, 2: 1, 3: 8, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!