ID: 1170561244_1170561249

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1170561244 1170561249
Species Human (GRCh38) Human (GRCh38)
Location 20:17560405-17560427 20:17560430-17560452
Sequence CCTGGTGTGATCTGCTGCACCAG AGGATCCTGAGAATTCCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 246} {0: 1, 1: 0, 2: 0, 3: 19, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!